View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14287_low_15 (Length: 275)
Name: NF14287_low_15
Description: NF14287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14287_low_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 22 - 275
Target Start/End: Original strand, 27778308 - 27778561
Alignment:
| Q |
22 |
tgctcattgtattgttgggttctttggtgatttttgtgtattcggttacacttagaggtcatgggaatattgaacctaataggtcatatttagaatatcg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27778308 |
tgctcattgtattgttgggttctttggtgatttttgtgtattcagttacacttagaggtcatgggaatattgaacctaataggtcatatttagaatatcg |
27778407 |
T |
 |
| Q |
122 |
tgtggatgatttttcattttggcttcgtagaagggttagaagttcacataaatgggatggaataaagagttgtcttagttcatcaaatatgtgtgctgag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27778408 |
agtggatgatttttcattttggcttcgtagaagggttagaagttcacataaatgggatggaataaagagttgtcttagttcatcaaatatgtgtgctgag |
27778507 |
T |
 |
| Q |
222 |
ttgaatcaaagttatagaattgctcaagannnnnnnaatgctcacctatcacct |
275 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27778508 |
ttgaatcaaagttatagaattgctcaagatttctttaatgctcacctatcacct |
27778561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 136
Target Start/End: Original strand, 12639499 - 12639591
Alignment:
| Q |
44 |
tttggtgatttttgtgtattcggttacacttagaggtcatgggaatattgaacctaataggtcatatttagaatatcgtgtggatgatttttc |
136 |
Q |
| |
|
|||||| |||||||| || |||||| ||| | |||||||| | ||||||||||||||| | ||||| ||||| ||| ||||||||||||| |
|
|
| T |
12639499 |
tttggttatttttgtttacatggttactcttcgtggtcatggtatgattgaacctaatagggcttatttggaataccgtttggatgatttttc |
12639591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University