View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14287_low_17 (Length: 247)
Name: NF14287_low_17
Description: NF14287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14287_low_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 6 - 247
Target Start/End: Complemental strand, 48416749 - 48416508
Alignment:
| Q |
6 |
aacaaaggcaacatttaactcgatcgtgattcggtggtgtaataaagcaggcaattttcatattattagatctcgatcattaattaaaattcgaacggtt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48416749 |
aacaaaggcaacatttaactcgatcgtgattcggtggtgtaataaagcacgcaattttcatattattagatctcgatcattaattaaaattcgaccggtt |
48416650 |
T |
|
| Q |
106 |
caaattaatatagttataaaatctttctaaacggtctcaatcacatgttttagattggatggtcttgatttgttacgtgttacaacatctcatctatcta |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48416649 |
caaattaatatagttataaaatctttctaaacgatctcaatcacatgttttagattggatggtcttgatttgttacgtgttacaacatcccatctatcta |
48416550 |
T |
|
| Q |
206 |
tgatgttaataattatgactttactttatgggattcaacacc |
247 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48416549 |
tggtgttaataattatggctttactttatgggattcaacacc |
48416508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 75 - 181
Target Start/End: Complemental strand, 35003536 - 35003430
Alignment:
| Q |
75 |
atctcgatcattaattaaaattcgaacggttcaaattaatatagttataaaatctttctaaacggtctcaatcacatgttttagattggatggtcttgat |
174 |
Q |
| |
|
||||||| ||||||||||| | ||| ||||||||| ||| | |||||||||| ||| || | |||||| |||||||||||||| ||||| || |||| |
|
|
| T |
35003536 |
atctcgaccattaattaaagattgaatggttcaaatcaatgcaattataaaatcattcaaaccaatctcaaccacatgttttagatcggatgatcctgat |
35003437 |
T |
|
| Q |
175 |
ttgttac |
181 |
Q |
| |
|
||||||| |
|
|
| T |
35003436 |
ttgttac |
35003430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University