View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14287_low_9 (Length: 332)
Name: NF14287_low_9
Description: NF14287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14287_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 15 - 317
Target Start/End: Original strand, 44155439 - 44155742
Alignment:
| Q |
15 |
aatattggtatgaagaatagtatttgcaagtacgtgaaagttgcggttgatggagctccatatctaagaaaagtggatcttgaagtttatgaatgttatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44155439 |
aatattggtatgaagaatagtatttgcaagtacgtgaaagttgcggttgatggagctccatatctaagaaaagtggatcttgaagtttatgaatgttatg |
44155538 |
T |
|
| Q |
115 |
acaatcttctcactgcattgaataccatgttttctactaattgcttcactattcgtacgtattcattcatcatc-aacaatgatatattgtgtttgtgtc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44155539 |
acaatcttctcactgcattgaataccatgttttctactaattgcttcactattcgtacgtattcattcatcatcaaacaatgatatattgtgtttgtgtc |
44155638 |
T |
|
| Q |
214 |
catgtcatttttatgtttcattaatatatgttgtgtgttatgagagtaatttgctttgtttttgtataccaactgttattaattaattattgcaggtaat |
313 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44155639 |
catgtcagttttatgtttcattaatatatgttgtgtgttatgagagtaatttgctttgtttttgtataccaactattattaattaattattgcaggtaac |
44155738 |
T |
|
| Q |
314 |
gatt |
317 |
Q |
| |
|
|||| |
|
|
| T |
44155739 |
gatt |
44155742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University