View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14288_high_7 (Length: 490)
Name: NF14288_high_7
Description: NF14288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14288_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 9 - 297
Target Start/End: Complemental strand, 32734946 - 32734658
Alignment:
| Q |
9 |
ttataccaaatcttgaccagttgctggagggtacgcctgcaaacattttttctactgtttggtttgaatggagaaagacaaagttctattcaactcatta |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32734946 |
ttatgccaaatcttgaccagttgctggagggtacgcctgcaaacattttttctactgtttggtttgaatggagaaagacaaagttctattcaactcatta |
32734847 |
T |
 |
| Q |
109 |
cagtgagcttattcgtcttgcagctttgtataagtaagttttcttggttgcgttggctagtattaataggtattagttgcttaattataattgtaaactg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32734846 |
cagtgagcttattcgtcttgcagctttgtataagtaagttttcttggttgcgttggctagtattaataggtatcagttgcttaattataattgtaaactg |
32734747 |
T |
 |
| Q |
209 |
attttgtgtatagatggtgttcactttagctttagtctattagttgactatttatgcagtgtagtcaaatagcggcactctagcgctat |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32734746 |
attttgtgtatagatggtgttcactttagctttagtctattagttgactatttatgcagtgtagtcaaatagcggcactctagcgctat |
32734658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University