View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14288_low_12 (Length: 230)
Name: NF14288_low_12
Description: NF14288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14288_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 43031362 - 43031164
Alignment:
| Q |
13 |
caaaggccaaagcgaacaatcacgtatagatttacaataccatacgtgtatggtttttgtttgagaggaagttcttatatgtatttacaatacatacgca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43031362 |
caaaggccaaagcgaacaatcacgtatagatttacaataccatacgtgtatggtttttgtttgagaggaagttcttatatgtatttacaatacatacgca |
43031263 |
T |
|
| Q |
113 |
tgctatgttcattgtcactagtactgaagcttcaccagaacactgagttgggaaagaagcaccctgtttatgatggtgcgaggaatttttacactcctag |
212 |
Q |
| |
|
| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43031262 |
tactatgttcattgtcactag---tgaagcttcaccagaacactgagttgggaaagaagcaccctgtttatgatggtgcgaggaatttttacactgctag |
43031166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 137 - 191
Target Start/End: Original strand, 46527159 - 46527213
Alignment:
| Q |
137 |
tgaagcttcaccagaacactgagttgggaaagaagcaccctgtttatgatggtgc |
191 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
46527159 |
tgaagtttcaccagaacactgaattgggaaagaagctccctgtttatgatggtgc |
46527213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University