View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14289_high_39 (Length: 334)
Name: NF14289_high_39
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14289_high_39 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0013 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 40 - 321
Target Start/End: Original strand, 39319 - 39595
Alignment:
| Q |
40 |
ccctattgatccaaatttacatagagaaatggattttgtacaatatttatcaattcaaggtgcgtcaacagaagtcccatttactgcttatttatcaaag |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39319 |
ccctattgatccaaatttacatagagaaatggatcttgtacagtatttatcgattcaaggtgcgtcaacagaagtcccatttactacttatttatcaaag |
39418 |
T |
 |
| Q |
140 |
agtnnnnnnnnnnnnnncaattacaaaggcatatcaaacccgctctcaaggtcccccgcctgcacctaatgaagannnnnnnctggaatttcaagggtat |
239 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39419 |
agtaaaaaaaaaa----caattacaaaggcatatcaaacccgctctcaaggtccccctcctgcacctaatgaagatttttttctggaatttcaagggtat |
39514 |
T |
 |
| Q |
240 |
agcttacgaaagtatgtatgaataatagagaccctttcatgcctaatctctgggcattatgggaataaggatgttgattttg |
321 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
39515 |
agcttacgaaattatgtatgaataatagagaccctttcatgcctaatctctgggcattatggg-gtaaggatattgattttg |
39595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 226 - 290
Target Start/End: Complemental strand, 29478977 - 29478913
Alignment:
| Q |
226 |
aatttcaagggtatagcttacgaaagtatgtatgaataatagagaccctttcatgcctaatctct |
290 |
Q |
| |
|
|||||||||||||||| |||| ||| | ||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
29478977 |
aatttcaagggtataggttacaaaattttgtatgaataataaagaccctttaaagcctaatctct |
29478913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 24575538 - 24575584
Alignment:
| Q |
256 |
tatgaataatagagaccctttcatgcctaatctctgggcattatggg |
302 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| |||||| |||||| |
|
|
| T |
24575538 |
tatgaacaatagagaccctttaatgcctaatctttgggcactatggg |
24575584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University