View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14289_high_50 (Length: 291)
Name: NF14289_high_50
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14289_high_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 24 - 141
Target Start/End: Original strand, 30869898 - 30870015
Alignment:
| Q |
24 |
aattaggtgacattcagtcacgaaagaaccattgagctcaactcgacctaagaaagatcaacgtacctaatcacttgattaaccatatacatcaaagtca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30869898 |
aattaggtgacattcagtcacgaaagaaccattgagctcaactcgacctaagaaagatcaacgtacctaatcacttgattaaccatatacatcaaagtca |
30869997 |
T |
|
| Q |
124 |
aactagaagatattccgg |
141 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30869998 |
aactagaagatattccgg |
30870015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 165 - 291
Target Start/End: Original strand, 30870016 - 30870143
Alignment:
| Q |
165 |
ccaaacaactataaagatgaattgtgatcccc-agaattgttatcctcgtgccatgtgtcatgcacgaactagaaacgtgtgaaggaaatgcttcatctt |
263 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30870016 |
ccaaacaactgtaaagatgaattgtgatcccccagaattgttatcctcgtgccgtgtgtcatgcacgaactagaaacgtgtgaaggaaatgcttcatctt |
30870115 |
T |
|
| Q |
264 |
catgcaccatctactaacgagttgtgta |
291 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30870116 |
catgcaccatctactaacgagttgtgta |
30870143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University