View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14289_high_52 (Length: 289)
Name: NF14289_high_52
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14289_high_52 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 88 - 289
Target Start/End: Complemental strand, 43367016 - 43366815
Alignment:
| Q |
88 |
tgatgcatacaccatcatcagtgaagagaaagaagacagacaagtccagaagactcatcggactccttcttgccagtttcctccgccgtcgtctcattca |
187 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43367016 |
tgatgcataaaccatcatcagtgaagagaaagaagacagacaagtccagaagactcatcggactccttctttccagtttcctccgccgtcgtctcattca |
43366917 |
T |
|
| Q |
188 |
ccgcctcctcatttccgccatctccgtctgccttctccttcttttcatcatgctctctctcttcgctccttccccttttattgtaaatgctcttcatcct |
287 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366916 |
tcgcctcctcatttcctccatctccgtctgccttctctttcttttcatcatgctctctctcttcgctccttccccttttattgtaaatgctcttcatcct |
43366817 |
T |
|
| Q |
288 |
tc |
289 |
Q |
| |
|
|| |
|
|
| T |
43366816 |
tc |
43366815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 54
Target Start/End: Complemental strand, 43367074 - 43367042
Alignment:
| Q |
22 |
atacatacaccaaactgtaattaatattcattc |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43367074 |
atacatacaccaaactgtaattaatattcattc |
43367042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University