View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14289_high_64 (Length: 253)
Name: NF14289_high_64
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14289_high_64 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 2 - 197
Target Start/End: Original strand, 30870124 - 30870319
Alignment:
| Q |
2 |
atctactaacgagttgtgtaagcgtggccaagtgtggtatgtatggacccttacaaccagttgtgtgagagtaatcccaatgtataacttaatgggtttg |
101 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30870124 |
atctactaacgagttgtgtaagcgtggacaagtgtggtacgcatggacccttacaaccagttgtgtgagagtaatcccaatgtataacttaatgggtttg |
30870223 |
T |
 |
| Q |
102 |
gttgacaaaagaaatatccattaggttaagaggttaatgctattaaacgatacacttcgaaggattagagggcactcttgacctaaagaatgtatt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
30870224 |
gttgacaaaagaaatatccattaggttaagaggttaattctattaaacgatacacttcgaaggattagagggcattcttgacctaaacaatctatt |
30870319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University