View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14289_high_65 (Length: 253)

Name: NF14289_high_65
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14289_high_65
NF14289_high_65
[»] chr1 (1 HSPs)
chr1 (1-239)||(3050818-3051056)


Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 3050818 - 3051056
Alignment:
1 tgcttttgttatcattccatgaaaaccttcatcttgtgttggcaattttggcattaacagcagggagtgctggagtggcgatagcagatgtgaccattga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3050818 tgcttttgttatcattccatgaaaaccttcatcttgtgttggcaattttggcattaacagcagggagtgctggagtggcgatagcagatgtgaccattga 3050917  T
101 tgcatgtgttgcacagaacagtatctctcatccttcccttgcttctgacatgcaaagtttatgtgcctttagttcttctattggcgcactattaggattc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3050918 tgcatgtgttgcacagaacagtatctctcatccttcccttgcttctgacatgcaaagtttatgtgcctttagttcttctattggcgcactattaggattc 3051017  T
201 tctattagtggcatctttgttcaccttataggccctatg 239  Q
    |||||||||||||||||||||||||||||||||||||||    
3051018 tctattagtggcatctttgttcaccttataggccctatg 3051056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University