View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14289_high_73 (Length: 239)

Name: NF14289_high_73
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14289_high_73
NF14289_high_73
[»] chr5 (1 HSPs)
chr5 (1-163)||(30886168-30886330)


Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 30886168 - 30886330
Alignment:
1 agtgaaagatcttaactactcaaatggatgaatgaattgattacacgatgcgtccgtaaaatcaaaagagaaatatactctaatgatgatgcaaattgca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||    
30886168 agtgaaagatcttaactactcaaatggatgaatgaattgattacacgatgcgtccgtaaaatcaaaaaagaaatatactataatgatgatgcaaattgca 30886267  T
101 atacattatgatttgtttaattgat-ggttaattaggggagctcgaagtaccgtcaacatcatg 163  Q
    ||||||||||||| | ||||||| | |||||||||||||||||||||| |||||||||||||||    
30886268 atacattatgattcg-ttaattgttgggttaattaggggagctcgaaggaccgtcaacatcatg 30886330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University