View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14289_low_28 (Length: 409)
Name: NF14289_low_28
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14289_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 394
Target Start/End: Complemental strand, 30285733 - 30285340
Alignment:
| Q |
1 |
tagattatatagtgacaaccataatctcttatcttcaagcattgcaaggcnnnnnnnnnnnnngtgcagtctttacatggtgctagatggtagtgttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30285733 |
tagattatatagtgacaaccataatctcttatcttcaagcattgcaaggcaaaaaggaaaaaagtgcagtctttacatggtgctagatggtagtgttcaa |
30285634 |
T |
 |
| Q |
101 |
ttttgctgcttgaccgacttctataaggtaattttgaatttgaaataattgatccatcgattgttcagtatgtggccacgttttctaaaacatgcatgnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30285633 |
ttttgctgcttgaccgacttctataaggtaattttgaatttgaaataattgatccatcgattgttcagtatgtggccacgttttctaaaacatgcatgcc |
30285534 |
T |
 |
| Q |
201 |
nnnnntaatcatgcaataaaatagggacaatggcttgcaattggatccacaagagtcaattctataaatgtgcactacgtacgtgcaaatgcaattgata |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30285533 |
ccccctaatcatgcaataaaatagggacaatggcttgcaattggatccacaagagtcaattctataaatgtgcactacgtacgtgcaaatgcaattgata |
30285434 |
T |
 |
| Q |
301 |
gtatcatagcctatcaaatatcaaccggattaagtggcttgtcaattgtcatgatctcatgtgaattgatggttcatagttcctgctgccctcc |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30285433 |
gtatcatagcctatcaaatatcaaccggattaagtggcttgtcaattgtcatgatctcatgtgaattgatggttcatagttcctgctgccctcc |
30285340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University