View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14289_low_57 (Length: 280)
Name: NF14289_low_57
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14289_low_57 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 107 - 280
Target Start/End: Original strand, 43855581 - 43855754
Alignment:
| Q |
107 |
aaacatagcttaacttattgggctacattgttttcagatttgcatcatacttggcctcctccttatgattttgtcaccaataggtggattgaggctaatc |
206 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43855581 |
aaacataacttatcttattgggctacattgttttcagatttgcattatacttggcctcctccttatgattctgtcaccaataggtggattgaggctaatc |
43855680 |
T |
|
| Q |
207 |
atactcaatgccaagtcctacggtttctatacttgaccattcatggatgcatgtgtataatggatgtaactttt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43855681 |
atactcaatgccaagtcctacggtttctatacttgaccattcatggatgcatgtgtataatggatgtaactttt |
43855754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 21 - 109
Target Start/End: Original strand, 43855396 - 43855484
Alignment:
| Q |
21 |
ttgtcttggttcaccaattgggtatgttcaattgcatcactcttcttgttatattttattttgatatctttagaggttgaaatataaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43855396 |
ttgtcttggttcaccaattgggtatgttcaattgcatcacacttcttgttatattttattttgatatctttagaggttgaaagataaaa |
43855484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University