View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14289_low_60 (Length: 268)
Name: NF14289_low_60
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14289_low_60 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 30885916 - 30886184
Alignment:
| Q |
1 |
tcatcaaaacgagattgaagacgactattagactagcctcgtggtgatatcataaaccaattgcattgcatatcattgtgctatttttggttgtctacat |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885916 |
tcatgaaaacgagattgaagacgactattagactagcctcgtggtgatatcataaaccaattgtattgcatatcattgtgctatttttggttgtctacat |
30886015 |
T |
 |
| Q |
101 |
taattcgagttatgcatgattgtaaacttttgtttttatatttaggggggaccgatcatttgatgctatgctatcattttaagaagtggggatcatttaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30886016 |
taattcgagttatgcatgattgtaaacttttgtttttatatttaggggggaccgatcatttgatgctatgctatcattttaggaagtggggatcatttaa |
30886115 |
T |
 |
| Q |
201 |
tgttatcatgttatgctaccattttaggaaaatggtggtgatatac-ctgcaagtgaaagatcttaact |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30886116 |
tgttatcatgttatgctaccattttaggaaaatggtggtgatatacgctgcaagtgaaagatcttaact |
30886184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University