View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14289_low_68 (Length: 250)
Name: NF14289_low_68
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14289_low_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 12271332 - 12271100
Alignment:
| Q |
1 |
tccaatgaagccttatttgttttctcttttaaccattttaacagagagattatcagtacaaccaactctgaggtcttttgcttaagaagcgcatccttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12271332 |
tccaatgaagccttatttgttttctcttttaaccattttaacagagagattatcagtacaaccaactctgaggtcttttgcttaagaagtgcatccttgc |
12271233 |
T |
|
| Q |
101 |
caagatgtcggagacaaagaatcaagctttattttagcttgtgctcagggacaacaaatgaatagattccttcatcctcaagaattgcatgatgcagtac |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12271232 |
caggatgtcggagacaaagaatcaagctttattttagcttgtgctcagggacaacaaatgaatagattccttcatcctcaagaattgcatgatgcagtac |
12271133 |
T |
|
| Q |
201 |
gacaaggcctgattggtttagtctaaccatact |
233 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
12271132 |
gacaaggcctaattggtttagtctaaccatact |
12271100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University