View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14289_low_74 (Length: 239)
Name: NF14289_low_74
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14289_low_74 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 225
Target Start/End: Original strand, 11751726 - 11751931
Alignment:
| Q |
20 |
cggctaagctttcaaattcagaatacagctgatactatcaaaaacagcttcaatgtcgtggctgttcatcctcaagacaggatggttcgctggaatagtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11751726 |
cggctaagctttcaaattcagaatacagctgatactatcaaaaacagcttcaatgtcgtggctgttcatcctcaagacaggatggttcgctggaatagtt |
11751825 |
T |
|
| Q |
120 |
ttaatcacagttgtcatgtgctaaatgtggagagtggctgtctaggagtgccaattcgagctggttatgtaggtgttattcgaaattctacagggttcta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
11751826 |
ttaatcacagttgtcatgtgctaaatgtggatagtagctgtctaggagtgccaattcgagctggttatgtaggtgttattcgatattttacagggttcta |
11751925 |
T |
|
| Q |
220 |
tctctc |
225 |
Q |
| |
|
|||||| |
|
|
| T |
11751926 |
tctctc |
11751931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 131 - 225
Target Start/End: Complemental strand, 7446274 - 7446180
Alignment:
| Q |
131 |
tgtcatgtgctaaatgtggagagtggctgtctaggagtgccaattcgagctggttatgtaggtgttattcgaaattctacagggttctatctctc |
225 |
Q |
| |
|
||||||||||| |||||||| || | ||| |||| ||||| ||||||||||||| || || |||||||| |||||| |||| ||||||||||| |
|
|
| T |
7446274 |
tgtcatgtgcttaatgtggacggtagttgtttaggtgtgcccattcgagctggttttggtggagttattcgcaattctgcaggtttctatctctc |
7446180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University