View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14289_low_79 (Length: 213)
Name: NF14289_low_79
Description: NF14289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14289_low_79 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 45179516 - 45179713
Alignment:
| Q |
14 |
aatatcagagaaaatgtttcaaaggcatgttgccaacctcgtctgtgaacccatggaagtaattacatattaaacacatgaatccccaaaaagaagaaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45179516 |
aatatcagagaaaatgtttcaaaggcatgttgccaacctcttctgtgaacccatggaagtaattacatattaaacacatgaatccccaaaaagaagaaga |
45179615 |
T |
 |
| Q |
114 |
cagaagtctgttcttcaaaatgtaagagagcaatccagtatttaaacaggctcgcct-----------agaaaattctactgctaagggtagaaactg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45179616 |
cagaagtctgttcttcaaaatgtaagagagcaatccagtatttaaacaggctcgcctagtttggtccaagaaaattctactgctaagggtagaaactg |
45179713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University