View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14291_high_7 (Length: 239)
Name: NF14291_high_7
Description: NF14291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14291_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 81 - 224
Target Start/End: Original strand, 7326714 - 7326851
Alignment:
| Q |
81 |
gcctacaataaatgtagtagtaaacccaaaccatcaactgagaaacatcaaacaatccttcactcnnnnnnnnn-ctgagaaacaatcctataattaacc |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
7326714 |
gcctacaataaatgtagtagtaaacccaaaccatcaactgagaaaca-------atccttcactcaaaagaaaaactgagaaacaatccaataattaacc |
7326806 |
T |
 |
| Q |
180 |
ggatgacataattgtttaagtatgattgagatataggtctttgat |
224 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7326807 |
ggatgacataattgtttaactatgattgagatataggtctttgat |
7326851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University