View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14291_high_9 (Length: 216)
Name: NF14291_high_9
Description: NF14291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14291_high_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 31771805 - 31771590
Alignment:
| Q |
1 |
tccatgctattgcatcgcgggcatggaattattttgtcaggtttcttcaaagttttttcttcagaaacactagtctcgctttgttctacatttgtagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31771805 |
tccatgctattgcatcgcgggcatggaattattttgtcaggtttcttcaaagttttttcttcagaaacactagtctcgctttgttctacatttgtagaag |
31771706 |
T |
|
| Q |
101 |
atttcaataaggaattctcggcttcagctgatggagtcttaggaggattctcatgtacaactgaagatgttgtgagagctgttaaatcctcggtggtttt |
200 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
31771705 |
atttcaataaagaattctcggtttcagctgatggagtcttaggaggattctcatgtacaactgaagatgttgtgagagctcttaaatcctcggtagtttt |
31771606 |
T |
|
| Q |
201 |
ttgcgaggcttcatca |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31771605 |
ttgcgaggcttcatca |
31771590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University