View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14291_low_10 (Length: 239)

Name: NF14291_low_10
Description: NF14291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14291_low_10
NF14291_low_10
[»] chr3 (1 HSPs)
chr3 (81-224)||(7326714-7326851)


Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 81 - 224
Target Start/End: Original strand, 7326714 - 7326851
Alignment:
81 gcctacaataaatgtagtagtaaacccaaaccatcaactgagaaacatcaaacaatccttcactcnnnnnnnnn-ctgagaaacaatcctataattaacc 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||          |||||||||||||| ||||||||||    
7326714 gcctacaataaatgtagtagtaaacccaaaccatcaactgagaaaca-------atccttcactcaaaagaaaaactgagaaacaatccaataattaacc 7326806  T
180 ggatgacataattgtttaagtatgattgagatataggtctttgat 224  Q
    ||||||||||||||||||| |||||||||||||||||||||||||    
7326807 ggatgacataattgtttaactatgattgagatataggtctttgat 7326851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University