View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14291_low_13 (Length: 210)
Name: NF14291_low_13
Description: NF14291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14291_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 13 - 156
Target Start/End: Original strand, 32823330 - 32823473
Alignment:
| Q |
13 |
ttccttcttcaacccttaagtgaaggtatccaaacttgatgcataataagaacgtgtgtggttatattttgcagatgaatttataatgtatggttctaat |
112 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32823330 |
ttccttcttcaacccttaggggaaggtatccaaacttgatgcataataagaacttgtgtggttatattttgcagatgaatttataatgtatgattctaat |
32823429 |
T |
 |
| Q |
113 |
atatggttctaacttctaagaatttataaatacattgttaagtt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32823430 |
atatggttctaacttctaagaatttataaatacattgttaagtt |
32823473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University