View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14291_low_7 (Length: 276)
Name: NF14291_low_7
Description: NF14291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14291_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 260
Target Start/End: Original strand, 7543169 - 7543424
Alignment:
| Q |
14 |
atgaattgttaattttgttgatcagatttgtagagaaatagacatttgtatannnnnnnnnnnnnnnacacacttatatagttttcataacctccagttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
7543169 |
atgaattgttaattttgttgatcagatttgtagagaaatagacatttgtatattttttagtttttttactcacttatatagttttcataacctccagttt |
7543268 |
T |
 |
| Q |
114 |
ttgtctattcattgatgtatattgatctaataatttatagtaaatgctctttgccaccactagtc---------nnnnnnnnttattttgattatgacta |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
7543269 |
ttgtctattcattgatgtatattgatctaataatttatagtaaatgctctttgccaccaatagtcaaaaaaattattttgatttattttgattatgacta |
7543368 |
T |
 |
| Q |
205 |
aaatgatggttgattgtatggtaggaagcatcaacggccaagtatatagtgcaaca |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7543369 |
aaatgatggttgattgtatggtaggaagcatcaacggccaagtatatagtgcaaca |
7543424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University