View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14291_low_8 (Length: 250)
Name: NF14291_low_8
Description: NF14291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14291_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 6360559 - 6360793
Alignment:
| Q |
1 |
acataccttttcttaaaaccccgaatttaagnnnnnnngatatggaaaattgttattcaatgaaatttgcttgtttaggattgtaatttgcttgtttgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6360559 |
acataccttttcttaaaaccccgaatttaagtttttttgatatggaaaattgttattcaatgaaatttgcttgtttaggattgtaatttgcttgt----t |
6360654 |
T |
 |
| Q |
101 |
tgtattttgatgcagatagaatggccatggaaaagtgtgacaatgtagtagtagtttcagcaatcttcaatgaccatgacaaaataagacaaccaaaggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6360655 |
tgtattttgatgcagatagaatggccatggaaaaatgtgacaaagtagtagtagtttcagcaatcttcaatgaccatgacaaaataagacaaccaaaggg |
6360754 |
T |
 |
| Q |
201 |
acttggaaccaaaacactagaaaatgtgtgtttcttcat |
239 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6360755 |
acttggaatcaaaacactagaaaatgtgtgtttcttcat |
6360793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 227
Target Start/End: Complemental strand, 13034011 - 13033959
Alignment:
| Q |
175 |
catgacaaaataagacaaccaaagggacttggaaccaaaacactagaaaatgt |
227 |
Q |
| |
|
||||||||||||||| ||||||| | || |||| ||||||||||||||||||| |
|
|
| T |
13034011 |
catgacaaaataagataaccaaatgtacatggacccaaaacactagaaaatgt |
13033959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University