View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14291_low_9 (Length: 249)
Name: NF14291_low_9
Description: NF14291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14291_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 2 - 232
Target Start/End: Complemental strand, 6360422 - 6360192
Alignment:
| Q |
2 |
tccaaagtgtagcttatgttgcaatcacaatgactcaccgtgttctactaccttcaccgtcaatccatacatgcattttatataatatcaaagaacacga |
101 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||| |
|
|
| T |
6360422 |
tccaaagtgtagcttgtgttgcaatcacaatgactcaccgtgttctactaccttcaccgtcaatccatacatgtattttatataatatcaaagatcgcga |
6360323 |
T |
 |
| Q |
102 |
tgcgaacatgattattatcgcgactgtcaattttaaaattcgttagaatatattaattaaaaccaatagaaacatcatggttgaatatttccaagtaaat |
201 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6360322 |
tgcgaacatgattattatggcgaccgtcgattttaaaattcgttagaatatattaattaaaaccaatagaaacatcatggttgaatatttccaagtaaat |
6360223 |
T |
 |
| Q |
202 |
tgagatataaccaaatgatttatacgtaact |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6360222 |
tgagatataaccaaatgatttatacgtaact |
6360192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University