View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14292_high_1 (Length: 331)
Name: NF14292_high_1
Description: NF14292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14292_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 79 - 317
Target Start/End: Original strand, 2362423 - 2362658
Alignment:
| Q |
79 |
ctggacagctaatatcttgcaaggtggtgagaattaagaaatactagtagtagtagtactcaagtcggtgtggtgaaggacaaacaagtactgctgttat |
178 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2362423 |
ctggacagctaatatcttgcaaggtagtgagaattaagaaatactagt---agtagtactcaagtcggtgtggtgaagaacaaaccagtactgctgttat |
2362519 |
T |
 |
| Q |
179 |
atttttatactacataatggaacagacctgttctgaccattcaatgaatacggttaataaattactagagattaatatttttaattactcttatgagagg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2362520 |
atttttatactacataatggaacagacctgttctgaccattcaatgaatacggttaataaattactagagattaatatttttaattactcttatgagagg |
2362619 |
T |
 |
| Q |
279 |
ttcgagatccgactgttttttagtcatactaatatttat |
317 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
2362620 |
ttcgagaaccgactgttttttagtcatactaatgtttat |
2362658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University