View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14293_high_6 (Length: 225)
Name: NF14293_high_6
Description: NF14293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14293_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 1099872 - 1100084
Alignment:
| Q |
1 |
taataatatgcaagtcaaatgtacattctagataacccctnnnnnnntaagatttgtcaatttcatactccatccgtcctaaatttaagcagnnnnnnnc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1099872 |
taataatatgcaagtcaaatgtacattctaggtaacccctaaaaaaataagatttgtcaatttcatactccatccgtcctaaatttaagcagtttttttc |
1099971 |
T |
 |
| Q |
101 |
tttacaatatcaagaaacatttattacttgttcaattatatcattaatcatttataacactattaannnnnnngtcnnnnnnngacactattaatttaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
1099972 |
tttacaatatcaagaaacatttattactttttcaattatatcattaatcatttataacactattaatttttttgtcaaaaaaagacactattaatttaat |
1100071 |
T |
 |
| Q |
201 |
tctttaatatata |
213 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
1100072 |
tctttaatttata |
1100084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University