View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14293_low_9 (Length: 246)
Name: NF14293_low_9
Description: NF14293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14293_low_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 52722569 - 52722324
Alignment:
| Q |
1 |
accaacaagagatgcgttccccaagtatgccagagctagctagctcctgctgtcagtggatgcattatgtccaccttagtgtttgcataatctgttatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52722569 |
accaacaagagatgcgttccccaagtatgccagagctagctagctcctgctgtcagtggatgcattatgtccaccttagtgtttgcataatctgttatca |
52722470 |
T |
|
| Q |
101 |
aactcttaatttattgtacaagtgtctgaaactgggacaacattcatgtgcaatgctgccaatcccaatctcttagcttcttaatttcaaataaaaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52722469 |
aactcttaatttattgtacaagtgtctgaaactgggacaacattcatgtgcaatgctgccaatcccaatctcttagcttcttaatttcaaataaaaaaca |
52722370 |
T |
|
| Q |
201 |
gacaagacactctcttggacttccacgtgatcagagaccaatccat |
246 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52722369 |
gacaagacactctcttggactttcacgtgatcagagaccaatccat |
52722324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University