View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_high_14 (Length: 256)
Name: NF14294_high_14
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 11 - 129
Target Start/End: Complemental strand, 46086940 - 46086822
Alignment:
| Q |
11 |
cacagattccacacaaagcgtgcgagttgccgttaacattcggcctctgatcacgtccgaacttctccttggttgcacagattgcatttctgttgttcct |
110 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46086940 |
cacagattccacacagagcgtgcgagttgccgtcaacattcggcctctgatcacgtccgaacttctccttggttgcacagattgcatttctgttgttcct |
46086841 |
T |
 |
| Q |
111 |
ggcgaacctcaggtgctac |
129 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
46086840 |
ggcgaacctcaggtgctac |
46086822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 240
Target Start/End: Complemental strand, 46086747 - 46086712
Alignment:
| Q |
205 |
aggtgcaaattggatctcattcctttacgtatgatt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46086747 |
aggtgcaaattggatctcattcctttacgtatgatt |
46086712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University