View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_high_19 (Length: 227)
Name: NF14294_high_19
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 136
Target Start/End: Complemental strand, 40385355 - 40385237
Alignment:
| Q |
18 |
atgtaaaggactgcaggcagacataattttgattgagttgtgttcaaagctaaacgcataaaagtaataatgtaaggtgcatataatctcgnnnnnnnac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40385355 |
atgtaaaggactgcaggcagacataattttgattgagttgtgttcaaagctaaacgcataaaagtaataatgtaaggtgcatataatctcgttttttttc |
40385256 |
T |
|
| Q |
118 |
tatttctttcaagctaaca |
136 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40385255 |
tatttctttcaagctaaca |
40385237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 40385235 - 40385195
Alignment:
| Q |
172 |
tgttgtgaaaatggaaattaaaacatgaaaaagtaatagtt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40385235 |
tgttgtgaaaatggaaattaaaacatgaaaaagtaatagtt |
40385195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University