View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_high_21 (Length: 215)
Name: NF14294_high_21
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 33620488 - 33620684
Alignment:
| Q |
1 |
cggtcaccttcgcctaagcaagagtctctcggagtatgacttgcaggaactcaatgcttgttttgaacttgggtttgggtttgattcaccggaaattgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33620488 |
cggtcaccttcgcctaagcaagagtctatcggagtatgacctgcaggaactcaatgcttgttttgaacttgggtttgggtttgattcaccggaaattgac |
33620587 |
T |
 |
| Q |
101 |
ccgaagctatcagatactttcccagctttggagttgtatcatgctgttaataaacaatatcataatcataacatgtcacgatcttcttcttcatctt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33620588 |
ccgaagctatcagatactttcccagctttggagttgtatcatgttgttaataaacaatatcataatcataacatgtcacgatcttcttcttcatctt |
33620684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University