View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14294_high_5 (Length: 361)

Name: NF14294_high_5
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14294_high_5
NF14294_high_5
[»] chr3 (3 HSPs)
chr3 (44-179)||(51938435-51938568)
chr3 (248-309)||(51938375-51938436)
chr3 (318-346)||(51938328-51938356)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 6e-62; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 44 - 179
Target Start/End: Complemental strand, 51938568 - 51938435
Alignment:
44 taagtattttttaatttgatcgatttggataataaaacccttaaatttctaccccctccacacaaaatcaagggtggatgattcttatgaattaagtcac 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51938568 taagtattttttaatttgatcgatttggataataaaacccttaaatttctaccccctccacacaaaatcaagggtggatgattcttatgaattaagtcac 51938469  T
144 gtattgacgatgactgtggtaaaagagaaatagaat 179  Q
    |||  ||||||||||||||||||||| |||||||||    
51938468 gta--gacgatgactgtggtaaaagaaaaatagaat 51938435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 248 - 309
Target Start/End: Complemental strand, 51938436 - 51938375
Alignment:
248 atctgaagaatggtaatatcttaaccagggtaaacatgaagctaacgtgtactacaactcat 309  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||    
51938436 atctgaacaatggtaatatcttaaccagggtaaacatgaagctaacgtgtaccacaactcat 51938375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 318 - 346
Target Start/End: Complemental strand, 51938356 - 51938328
Alignment:
318 aatgatcgttgcaattgcattgtattttt 346  Q
    |||||||||||||||||||||||||||||    
51938356 aatgatcgttgcaattgcattgtattttt 51938328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University