View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14294_high_7 (Length: 318)

Name: NF14294_high_7
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14294_high_7
NF14294_high_7
[»] chr8 (2 HSPs)
chr8 (194-299)||(5907345-5907445)
chr8 (1-113)||(5907148-5907264)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 194 - 299
Target Start/End: Original strand, 5907345 - 5907445
Alignment:
194 gagttcaagacgatgattatattttcattaccgtgggtgcctatgattagattagttaaaaaatagggattgtcttggacaatatttttcttaaaattaa 293  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||     |||||||||||||||||||| ||||||||||||||||||||||||||    
5907345 gagttcaagacgatgattatattttcatcaccgtgggtgcctatgatt-----agttaaaaaatagggattgtattggacaatatttttcttaaaattaa 5907439  T
294 aagctg 299  Q
    ||||||    
5907440 aagctg 5907445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 5907148 - 5907264
Alignment:
1 tatatttaaatcattgataatacatgatatatgt----ttcgagtttcacacctcatacaccacaaaaagaaaaatcattgattttatgtttttgtcgta 96  Q
    ||||||||||||||||||||||||| ||| ||||    |||||||||||||||||| ||||  |||||| ||||||||||||||||||||||||||||||    
5907148 tatatttaaatcattgataatacataataaatgtaaagttcgagtttcacacctcaaacactgcaaaaataaaaatcattgattttatgtttttgtcgta 5907247  T
97 tgactaacaacttaatt 113  Q
    |||| ||||||||||||    
5907248 tgacgaacaacttaatt 5907264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University