View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_high_9 (Length: 300)
Name: NF14294_high_9
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 25644639 - 25644919
Alignment:
| Q |
1 |
ttagtgaagaaaggaaggcaaatatcaaagggccctggctacattgaccctcgatgttacaaaaacacaaaacaagacaaattcttgttgtctctttcaa |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25644639 |
ttagtgaagaaaggaaagcaaatatcaaacggccctggctacattgaccctcgatgttacaaaaacacaaaacaagacaaatttttgttgtctctttcaa |
25644738 |
T |
 |
| Q |
101 |
aaaccttgctctacataagacatcaatgcaaataatcaccaagaccatacatgttgcatttttggcacatagaatatagtgctttttgatagacaaagac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25644739 |
aaaccttgctctacataagacatcaatgcaaataatcaccaagaccatacatgttgcatttttggcacatagaata-agtgctttttgatagacaaagac |
25644837 |
T |
 |
| Q |
201 |
acttctagtatgcaacaattacatgcaaaatctacattgaactttcactacattaatatcactcataagatatatagcattc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25644838 |
acttctagtatgcaacaattacatgcaaaatctacattgaactttcactacattaatatcactcataagatatatagcattc |
25644919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University