View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_low_11 (Length: 296)
Name: NF14294_low_11
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 4611027 - 4611198
Alignment:
| Q |
1 |
cctttgtcaagttatttcctatggaatgcactaaaaacaat-tgagaaacaacttgaaatgttcaatgctacataaaaagattgggaatctttgggacat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4611027 |
cctttgtcaagttatttcctatggaatgcactaaaaacaaaatgagcaaca-cttgaaatgttcaatgctacataaaa-gattgggaatctttgggacat |
4611124 |
T |
 |
| Q |
100 |
caaattgcagattgggaacagtttcaaa-ttacttctaaatagttgaaatgtctgacactagaacaacaatttg |
172 |
Q |
| |
|
||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4611125 |
caaattgcagattggtaatagtttcaaatttacttctaaatagttgaaatgtctgacactagaacaacagtttg |
4611198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 236 - 288
Target Start/End: Original strand, 4611449 - 4611501
Alignment:
| Q |
236 |
caaagcaagccaaaacgtttggtttgggtctatgaaacacgaatacggacaga |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||| |||| |||||| |
|
|
| T |
4611449 |
caaagcaagccaaaacgtttggtttgggtctttgaagcacggatacagacaga |
4611501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University