View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_low_12 (Length: 286)
Name: NF14294_low_12
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 5826588 - 5826319
Alignment:
| Q |
1 |
ataaatcacacatgtaagaaaattaatacacctaatgatggtaaatttcannnnnnnnggggcagcaaggtagcctagagtaaatttcaataatatagga |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5826588 |
ataaatcgcacatgtaagaaaattaatacacctaatgatggtaaatttgattttttttggggcagcaaggtagcttagagtaaatttcaataatatagga |
5826489 |
T |
 |
| Q |
101 |
attaatatttcggctgaattaaaaaggttaaattctaaaaaattcaggccttatctaaagagaatgatgaatggaccacttgtatacgtataattgtctt |
200 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5826488 |
attaatatttaggttgaattaaaaaggttaaattctaaaaaattcaggccttatctaaagagaatgatgaatggaccacttgtatacgtataattgtctt |
5826389 |
T |
 |
| Q |
201 |
ttgttacatatctatgttgtttgtctccgttggtttgcctcggacaactttcaccttcaccagttcttgt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5826388 |
ttgttacatatctatgttgtttgtctccgttggtttgcctcggacaactttcaccttcaccagttcttgt |
5826319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University