View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_low_20 (Length: 234)
Name: NF14294_low_20
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 12 - 192
Target Start/End: Original strand, 14231307 - 14231487
Alignment:
| Q |
12 |
atagcaaaaacagaataataataaaaattgcttctactatgccaatgagtatgttcctgcaaattgcacatcaaagaatttgcaaagtacagtgatgcca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14231307 |
atagcaaaaacagaataataataaaaattgcttctattatgccaatgagtatgttcttgcaaattgcacatcaaagaattttcaaagtacagtgatgcca |
14231406 |
T |
 |
| Q |
112 |
cagttaatgtcataattcaaagttaaatatatcatcatctggatcaaattcatcttcgcaagtatcatccttcctcccaaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14231407 |
cagttaatgtcataattcaaagttaaatatatcatcatctggatcaaattcatcttcgcaagtatcatccctcctcccaaa |
14231487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University