View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14294_low_20 (Length: 234)

Name: NF14294_low_20
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14294_low_20
NF14294_low_20
[»] chr2 (1 HSPs)
chr2 (12-192)||(14231307-14231487)


Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 12 - 192
Target Start/End: Original strand, 14231307 - 14231487
Alignment:
12 atagcaaaaacagaataataataaaaattgcttctactatgccaatgagtatgttcctgcaaattgcacatcaaagaatttgcaaagtacagtgatgcca 111  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||    
14231307 atagcaaaaacagaataataataaaaattgcttctattatgccaatgagtatgttcttgcaaattgcacatcaaagaattttcaaagtacagtgatgcca 14231406  T
112 cagttaatgtcataattcaaagttaaatatatcatcatctggatcaaattcatcttcgcaagtatcatccttcctcccaaa 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
14231407 cagttaatgtcataattcaaagttaaatatatcatcatctggatcaaattcatcttcgcaagtatcatccctcctcccaaa 14231487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University