View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_low_22 (Length: 220)
Name: NF14294_low_22
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 19 - 163
Target Start/End: Complemental strand, 7579806 - 7579662
Alignment:
| Q |
19 |
atccgattgcttataatgttggaaaagtgacgtatgaactttgaagtgcaaatccttctaatatatgaattattgatgtggttggtttatgcatttaact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7579806 |
atccgattgcttataatgttggaaaagtgacgtatgaactttgaagtgcaaatccttctaatatatgaattattgacgtggttggtttatgcatttaact |
7579707 |
T |
|
| Q |
119 |
gcatgagttatatttctttcattttcaatggataatcagaataat |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7579706 |
gcatgagttatatttctttcattttcaatggataatcaggataat |
7579662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University