View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_low_25 (Length: 207)
Name: NF14294_low_25
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_low_25 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 26126334 - 26126128
Alignment:
| Q |
1 |
aagatttggagtaggaaatatattgttggaatcacataaatgatgttgttcaaaagacgaaggtgtaagaaatagttcacatgttttggtcgggaggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26126334 |
aagatttggagtaggaaatatattgttggaatcacataaatgatgtagttcaaaagacgaaggcgtaagaaatagttcacgtgttttggtcgggaggaaa |
26126235 |
T |
 |
| Q |
101 |
gatatgatgctacaaaacactctatcggactttgtgccttacgacattctatctttactactgatcaaaacatgtgtaggctacgatgagctatgtctct |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26126234 |
gataggatgctacaaaacactctatcggactttgtgccttacgacattctatctttactactgatcaaaacatgtgtaggctacgatgagctatgtctct |
26126135 |
T |
 |
| Q |
201 |
caccggt |
207 |
Q |
| |
|
||||||| |
|
|
| T |
26126134 |
caccggt |
26126128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University