View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_low_6 (Length: 361)
Name: NF14294_low_6
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 6e-62; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 44 - 179
Target Start/End: Complemental strand, 51938568 - 51938435
Alignment:
| Q |
44 |
taagtattttttaatttgatcgatttggataataaaacccttaaatttctaccccctccacacaaaatcaagggtggatgattcttatgaattaagtcac |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51938568 |
taagtattttttaatttgatcgatttggataataaaacccttaaatttctaccccctccacacaaaatcaagggtggatgattcttatgaattaagtcac |
51938469 |
T |
|
| Q |
144 |
gtattgacgatgactgtggtaaaagagaaatagaat |
179 |
Q |
| |
|
||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
51938468 |
gta--gacgatgactgtggtaaaagaaaaatagaat |
51938435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 248 - 309
Target Start/End: Complemental strand, 51938436 - 51938375
Alignment:
| Q |
248 |
atctgaagaatggtaatatcttaaccagggtaaacatgaagctaacgtgtactacaactcat |
309 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51938436 |
atctgaacaatggtaatatcttaaccagggtaaacatgaagctaacgtgtaccacaactcat |
51938375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 318 - 346
Target Start/End: Complemental strand, 51938356 - 51938328
Alignment:
| Q |
318 |
aatgatcgttgcaattgcattgtattttt |
346 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51938356 |
aatgatcgttgcaattgcattgtattttt |
51938328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University