View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14294_low_8 (Length: 318)
Name: NF14294_low_8
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14294_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 194 - 299
Target Start/End: Original strand, 5907345 - 5907445
Alignment:
| Q |
194 |
gagttcaagacgatgattatattttcattaccgtgggtgcctatgattagattagttaaaaaatagggattgtcttggacaatatttttcttaaaattaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5907345 |
gagttcaagacgatgattatattttcatcaccgtgggtgcctatgatt-----agttaaaaaatagggattgtattggacaatatttttcttaaaattaa |
5907439 |
T |
 |
| Q |
294 |
aagctg |
299 |
Q |
| |
|
|||||| |
|
|
| T |
5907440 |
aagctg |
5907445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 5907148 - 5907264
Alignment:
| Q |
1 |
tatatttaaatcattgataatacatgatatatgt----ttcgagtttcacacctcatacaccacaaaaagaaaaatcattgattttatgtttttgtcgta |
96 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| |||||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5907148 |
tatatttaaatcattgataatacataataaatgtaaagttcgagtttcacacctcaaacactgcaaaaataaaaatcattgattttatgtttttgtcgta |
5907247 |
T |
 |
| Q |
97 |
tgactaacaacttaatt |
113 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
5907248 |
tgacgaacaacttaatt |
5907264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University