View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_high_30 (Length: 307)
Name: NF14295_high_30
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_high_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 306
Target Start/End: Original strand, 780399 - 780674
Alignment:
| Q |
19 |
tctgccgtatacacgaattctaccaaagttagaggctgtaaagattttcatgtggtggtggccggaatttgcagacatggagcataccaatgaaagtgga |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
780399 |
tctgccgtatacacgaattctactaaagttagaggctgtaaagattttcatgtggtggtggccggaatttgcagacatggagcataccaatgaaagtgga |
780498 |
T |
|
| Q |
119 |
aagtggaaggcgcgcggaaggagatgttgggggaaagaagagaagataaagaaaatttagtgtggataatgtccacaacatttcgatctttaattaatct |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
780499 |
aagtggaag----gcggaaggagatgttgggggaaagaagagaagataaagaaaatttagtgtggatgatgtccacaacatttcgatct----ttaatct |
780590 |
T |
|
| Q |
219 |
aataataagaaaaagttagttatgcaccatacaacacttgatttagttgtgcacatgtagccacttgacaaatttggcggatcaatgt |
306 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||| |||||||||| |
|
|
| T |
780591 |
aataataagaaaa----agttatgcaccatacaacatttgatttagttgtgcacatgtagccacttgacaattatggaggatcaatgt |
780674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University