View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_high_37 (Length: 254)
Name: NF14295_high_37
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_high_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 47470023 - 47469785
Alignment:
| Q |
1 |
ttctccttcaccgaacacagcgagtatagagccgttgacgcgtcctttttcccgcggattcctccattttctagaaggttcaccaatgccggaattgcac |
100 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47470023 |
ttctcgttcaccgaacacagcgagtataaagccgttgacgcatcctttttcccgcggattcctccgttttctagaaggttcaccaatgccggaattgcac |
47469924 |
T |
|
| Q |
101 |
cacatcttccaattgctcctttattctcttctgtctgtgagagacgaagtagagcacatgctgcattctctttcgccgttggagtgcctgttttcaaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469923 |
cacatcttccaattgctcctttattctcttctgtctgtgagagacgaagtagagcacatgctgcattctctttcgccgttggagtgcctgttttcaaagc |
47469824 |
T |
|
| Q |
201 |
ttttaccataggtttaatcgcaccagaagaagtgataat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469823 |
ttttaccataggtttaatcgcaccagaagaagtgataat |
47469785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 5220752 - 5220864
Alignment:
| Q |
1 |
ttctccttcaccgaacacagcgagtatagagccgttgacgcgtcctttttcccgcggattcctccattttctagaaggttcaccaatgccggaattgcac |
100 |
Q |
| |
|
||||||||||| |||||||| | || || ||||| ||||||||||| |||||||| ||||||||| || ||||||| ||||||||| ||||||||||| |
|
|
| T |
5220752 |
ttctccttcacagaacacagagtatacagcgccgtagacgcgtccttcttcccgcgtattcctccacttcctagaagattcaccaataacggaattgcac |
5220851 |
T |
|
| Q |
101 |
cacatcttccaat |
113 |
Q |
| |
|
| |||||||||| |
|
|
| T |
5220852 |
cggatcttccaat |
5220864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University