View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_high_50 (Length: 220)
Name: NF14295_high_50
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_high_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 35398872 - 35398670
Alignment:
| Q |
1 |
aagtagaactagttatttaatctattgtcatgcattcaaagcacagcctatgcacttgtgtgggatagagaaaaaacataattgacaaaaatcagaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35398872 |
aagtagaactagttatttaatctattgtcatgcattcaaagcacagcctatgcccttgtgtgggatagagaaaaaacataattgacaaaaatcagaattt |
35398773 |
T |
 |
| Q |
101 |
acaacctttgtgcatcacagttatgcatcgtatcgatatttagtgaacaacttccaaagagtaataaacatcattgtaattcaaaacagaaacagctgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35398772 |
acaacctttgtgcatcacagttatgcatcgtatcgatatttagtgaacaacttccaaagagtaataaacatcattgtaattcaaaacagaaacaactgtt |
35398673 |
T |
 |
| Q |
201 |
act |
203 |
Q |
| |
|
||| |
|
|
| T |
35398672 |
act |
35398670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University