View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14295_high_53 (Length: 207)

Name: NF14295_high_53
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14295_high_53
NF14295_high_53
[»] chr8 (1 HSPs)
chr8 (12-190)||(41785732-41785910)
[»] chr6 (1 HSPs)
chr6 (26-97)||(10835111-10835178)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 41785732 - 41785910
Alignment:
12 gaggagcacagagagtgtgtcatgagcaatgtgtctaaaatgctttgtgaggttcagtttgcgaaggattggataaagaaaatgaacgtcgaaatgaaac 111  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41785732 gaggaacacagagagtgtgtcatgagcaatgtgtctaaaatgctttgtgaggttcagtttgcgaaggattggataaagaaaatgaacgtcgaaatgaaac 41785831  T
112 aattgaaggaaaatgtggattgtcttacaacgctactgagcgaaaaagaagagcaggaattgttgttaagagacaaagt 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41785832 aattgaaggaaaatgtggattgtcttacaacgctactgagcgaaaaagaagagcaggaattgttgttaagagacaaagt 41785910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 97
Target Start/End: Original strand, 10835111 - 10835178
Alignment:
26 gtgtgtcatgagcaatgtgtctaaaatgctttgtgaggttcagtttgcgaaggattggataaagaaaatgaa 97  Q
    |||||||||||||| ||| |||||||| ||    ||||||| |||||| |||||| ||||||||||||||||    
10835111 gtgtgtcatgagcagtgtttctaaaattct----gaggttcggtttgctaaggataggataaagaaaatgaa 10835178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University