View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_low_25 (Length: 326)
Name: NF14295_low_25
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 6 - 309
Target Start/End: Original strand, 33885228 - 33885530
Alignment:
| Q |
6 |
ggagctatgaaccttgttcccttttggttaatttacctcgtttcaacaattacctctgcagtcatatgaaagctttatacttattattattcttatttat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33885228 |
ggagctatgaaccttgttcccttttggttaatttacctcgtttcaacaattac-tctgcagtcatatgaaagctttatacttattattactcttatttat |
33885326 |
T |
 |
| Q |
106 |
ctcaatgattcattacgaatattatgtcacatctgcaaccgttaaaaaacaagaagtaaaagagagaaaggaaacatacagaattaaagattaaaagcta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33885327 |
ctcaatgattcattacgaatattatgtcacatctgcaaccgttaaaaaacaagaagtaaaagagagaaaggaaacatacagaattaaagattaaaagcta |
33885426 |
T |
 |
| Q |
206 |
cttttttatttacctaattgatgaagcaagctattagttaggtatgctatatatgttaaagacaatagcacttgctaatttggctagtgggtatatattg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33885427 |
cttttttatttacctaattgatgaagcaagctactagttaggtatgctatatatgttaaagacaatagcacttgctaatttggctagtgggtatatattg |
33885526 |
T |
 |
| Q |
306 |
tcat |
309 |
Q |
| |
|
|||| |
|
|
| T |
33885527 |
tcat |
33885530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University