View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_low_30 (Length: 308)
Name: NF14295_low_30
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 4 - 286
Target Start/End: Complemental strand, 23338832 - 23338551
Alignment:
| Q |
4 |
gaaatgaaagaagaaaaacaaattttcnnnnnnnngggggtagggagcctcctattttttcctgtgatgacacgtgtacggttgatgtgatgttttgggg |
103 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23338832 |
gaaatgaaagaagaaaaacaaattttcaaaaaaa-gtgggtagggagcctcctattttttcctgtgatgacacgtgtacggttgatgtgatgttttgggg |
23338734 |
T |
 |
| Q |
104 |
ctggatcaccgactgatgactaattcttgagagtgggaccttcatttagctttaggaccaaaccgactataagattgtttatagggtggtgatgtggact |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23338733 |
ctggatcaccgactgatgactaattcttgagagtgggaccttcatttagctttaggatcaaaccgactataagattgtttatagggtggtgatgtggact |
23338634 |
T |
 |
| Q |
204 |
ttacattagccaacattgggttagttaagttgtgctagtttcattatcaataagtacattctatgattttgtaaaattatcgt |
286 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
23338633 |
ttacattagccaacattggtttagttaagttgtgctagtttcattatcaatgattacattctatgattttgtaaaattatcgt |
23338551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University