View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_low_35 (Length: 280)
Name: NF14295_low_35
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 86 - 265
Target Start/End: Original strand, 52722159 - 52722338
Alignment:
| Q |
86 |
taatataaaccgtgaaagacatataaaatagttttgattggtgtcaactgaacatatataattctattcatcttttgttgatgggtaatgtagttaccgc |
185 |
Q |
| |
|
||||||||||||| ||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52722159 |
taatataaaccgtaaaagacaaatgaaatagttttgattggtgtcaactgaatatatataattctattcatcttttgttgatgggtaatgtagttaccgc |
52722258 |
T |
|
| Q |
186 |
aaataaagaatacgtgggttctttctacattaattaattgtaagattaattaacatgcatggataatggattggtctctg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52722259 |
aaataaagaatacgtgggttctttctacattaattaattgtaagattaattaacatgcatggataatggattggtctctg |
52722338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 52720521 - 52720596
Alignment:
| Q |
19 |
agagttacccatattgagttcgtatcgatcaaaattattcatatgcccactatataaactatatctataatataaa |
94 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
52720521 |
agagttacccatattgagttcgcatcaatcaaaatcattcatatgcccgctatataaactatatatataatataaa |
52720596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University