View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_low_43 (Length: 250)
Name: NF14295_low_43
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 2 - 246
Target Start/End: Original strand, 780661 - 780905
Alignment:
| Q |
2 |
tggaggatcaatgttgcagtcgcatggaattagattttagcaacaaatgatcactatagcaagttctctcgatgaaacattgtagagagaatcc-taaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||||| || ||||| |
|
|
| T |
780661 |
tggaggatcaatgttgcagtcgcatggaattagattttagcgacaaatgatca-tatagcaagttctctcgatgaaacattgtatagagaaaccctaaaa |
780759 |
T |
 |
| Q |
101 |
acaaagaagaaaaatgaccattaaatttcaataataggccatatcaatggctttatccctcaagtttcttgctgaatttgatgtttttcatctgatgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
780760 |
acaaagaagaaaaatgaccattaaatttcaataataggccatatcaatggctttatccctcaagtttcttgctgaatttgatgtttttcatctgatgttt |
780859 |
T |
 |
| Q |
201 |
aaatttttcctcttcaacgtgtacttgagaatatttcttctcactc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
780860 |
aaatttttcctcttcaacgtgtacttgagaatatttcttctcactc |
780905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University