View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_low_46 (Length: 242)
Name: NF14295_low_46
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_low_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 68 - 227
Target Start/End: Original strand, 8442288 - 8442444
Alignment:
| Q |
68 |
ataccaactcaagcaactaataaaacacataatattcttctacattcaaaactaaatatccaaaagatacaaaataaattgggtttgggtcatctgggac |
167 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8442288 |
ataccaactcatgcaactaataaaacacataatattct---acattcaaaactaaatatccaaaagatacaaaataaattgggtttgggtcatctgggac |
8442384 |
T |
|
| Q |
168 |
ccgagacttatgttttcgccaattataaaaaggaatacttaataaatttaactatgtttt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8442385 |
ccgagacttatgttttcgccaattataaaaaggaatagttaataaatttaactatgtttt |
8442444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 35398857 - 35398813
Alignment:
| Q |
1 |
tttaatctattgtcatgcattcaatgcacagcctatgcacttgtg |
45 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
35398857 |
tttaatctattgtcatgcattcaaagcacagcctatgcccttgtg |
35398813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University