View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_low_54 (Length: 211)
Name: NF14295_low_54
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 32961213 - 32961038
Alignment:
| Q |
18 |
atcactagaccaatcccaaaccacctagccataaagctctctctttagtctcaatgaatctttgaaccacaaagagaaaaatgtccctagccccaagtga |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32961213 |
atcactagaccaatcccaatccacctagccataaagctctctctttagtctcaatgaatctttgaaccacaaagagaaaaatgtccctagccccaagtga |
32961114 |
T |
 |
| Q |
118 |
gaatgtgagataaagacagacattccagttgtatcttgttgcttttgaggaatataattttatgtgttcccgaagt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32961113 |
gaatgtgagataaagacagacattccagttgtatcttgttgcttttgaggaatataattttatgtgttcccgaagt |
32961038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 193
Target Start/End: Original strand, 7715736 - 7715799
Alignment:
| Q |
130 |
aagacagacattccagttgtatcttgttgcttttgaggaatataattttatgtgttcccgaagt |
193 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| |||||||| |||||| |||| |
|
|
| T |
7715736 |
aagacaaacattccagttgtatgttgttgcttttgaggaatgcaattttattcgttcccaaagt |
7715799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University